Non-radioactive Probes
I. Via random hexamers
1. Solutions:
10X hexa nt mix*:
500 mM Tris-Cl pH 7.2
100 mM MgCl2
1 mM dithioerythritol (DTE)
2 mg/ml BSA
62.5 A260 units/ml (1.56 mg/ml) random hexanucleotides
10x dig/dNTP mix*:
1 mM dATP
1 mM dCTP
1 mM dGTP
0.65 mM dTTP
0.35 mM alkali-labile digoxigenin (dig)-UTP (B-Mann cat# 1573152 or 1573179)
*supplied in the dig DNA labelling kit; also can order all tubes separately, i.e. without enzyme.
2. Reaction:
a. Heat at 100 deg C for 10' to denature: 15 µl (50-250ng) DNA (in TE or ddH2O)
b. Cool quickly on ice (1-2')
c. Add:
2 µl 10X hexa nt mix
2 µl 10X dig/dNTP mix
1 µl Klenow* (5u/µl)
d. Incubate at 37 deg C >1 hr. (up to 20 hr)
e. Increase volume to 50 µl; then add 5 µl 0.4 M EDTA pH 8
f. Purify through a G-50 spin column.
II. Via PCR
1. Solutions:
10X PCR buffer:
100 mM Tris-Cl, pH 8.3
500 mM KCl
10X dig mix:
2 mM dATP
2 mM dCTP
2 mM dGTP
1.3 mM dTTP
0.7 mM alkali-labile dig-11-dUTP (B-Mann cat# 1573152 or 1573179)
2. Reaction:
10X PCR buffer 5 µl
25 mM MgCl2 3 µl
10X dig mix 5 µl
20 pmol oligo 1
20 pmol oligo 2
Template
Taq 1 µl
Water up to 50 µl
3. PCR:
94 deg C - 5 min
Then 35 cycles of:
94 deg C - 30 sec
50 deg C - 1 min
70 deg C - 2 min
4. To purify, spin through a G-50 column or gel-isolate fragment (depending on the purity of the amplification).
III. Riboprobe synthesis (Recommended for Northerns)
1. Solutions:
10X NTP mixture:
10 mM ATP
10 mM CTP
10 mM GTP
6.5 mM UTP
3.5 mM DIG-UTP
2. Reaction:
a. Add the following reagents in order on ice:
*Purified template (1 µg) + dH20 in 13 µl
10X NTP mix 2 µl
10X Transcription buffer 2 µl
RNase inhibitor 1 µl
RNA polymerase (SP6, T3 or T7) 2 µl
*Purified template can be from a variety of sources:
1. Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify.
2. PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment.
For T3: ATCGAAATTAACCCTCACTAAAGGG
For T7: ATCGATAATACGACTCACTATAGGG
b. Incubate for 2 hours at 37 deg C.
c. Add 2 µl DNase I and incubate 15 minutes at 37 deg C.
d. Add 2 µl 0.2 M EDTA to stop reaction
e. Purify on G-50
End-labeling Ladder
1. On ice mix:
32 µl sample (10 µg 1kb ladder (BRL) + H2O
5 µl 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl2, 100 mM DTT)
1 µl dig-UTP (alkali-stable; B-Mann cat. #1093088 or 1558706)
2 µl T4 DNA Polymerase (1u/µl)
2. Incubate 5' at 37 deg C.
3. On ice add:
5 µl 1 mM dATP,dGTP
5 µl 1 mM dCTP
4. Incubate 15' at 30 deg C.
5. Add 6 µl stop solution (2% Sarkosyl 0.4 M EDTA pH 8.0).
6. Purify on G-50 spin column.
上一篇:Northern Hybridization of RNA Fracti 下一篇:Northern blot技术