Non-radioactive Probes

I. Via random hexamers

1. Solutions:

10X hexa nt mix*:

500 mM Tris-Cl pH 7.2

100 mM MgCl₂

1 mM dithioerythritol (DTE)

2 mg/ml BSA

62.5 A260 units/ml (1.56 mg/ml) random hexanucleotides

10x dig/dNTP mix*:

1 mM dATP

1 mM dCTP

1 mM dGTP

0.65 mM dTTP

0.35 mM alkali-labile digoxigenin (dig)-UTP (B-Mann cat# 1573152 or 1573179)

*supplied in the dig DNA labelling kit; also can order all tubes separately, i.e. without enzyme.

2. Reaction:

a. Heat at 100 deg C for 10' to denature: 15 µl (50-250ng) DNA (in TE or ddH₂O)

b. Cool quickly on ice (1-2')

c. Add:

2 µl 10X hexa nt mix

2 µl 10X dig/dNTP mix

1 µl Klenow* (5u/µl)

d. Incubate at 37 deg C >1 hr. (up to 20 hr)

e. Increase volume to 50 µl; then add 5 µl 0.4 M EDTA pH 8

f. Purify through a G-50 spin column.

--------------------------------------------------------------------------------

II. Via PCR

1. Solutions:

10X PCR buffer:

100 mM Tris-Cl, pH 8.3

500 mM KCl

10X dig mix:

2 mM dATP

2 mM dCTP

2 mM dGTP

1.3 mM dTTP

0.7 mM alkali-labile dig-11-dUTP (B-Mann cat# 1573152 or 1573179)

2. Reaction:

10X PCR buffer 5 µl

25 mM MgCl₂ 3 µl

10X dig mix 5 µl

20 pmol oligo 1

20 pmol oligo 2

Template

Taq 1 µl

Water up to 50 µl

3. PCR:

94 deg C - 5 min

Then 35 cycles of:

94 deg C - 30 sec

50 deg C - 1 min

70 deg C - 2 min

4. To purify, spin through a G-50 column or gel-isolate fragment (depending on the purity of the amplification).

III. Riboprobe synthesis (Recommended for Northerns)

1. Solutions:

10X NTP mixture:

10 mM ATP

10 mM CTP

10 mM GTP

6.5 mM UTP

3.5 mM DIG-UTP

2. Reaction:

a. Add the following reagents in order on ice:

*Purified template (1 µg) dH₂O in 13 µl

10X NTP mix 2 µl

10X Transcription buffer 2 µl

RNase inhibitor 1 µl

RNA polymerase (SP6, T3 or T7) 2 µl

*Purified template can be from a variety of sources:

1. Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify.

2. PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment.

For T3: ATCGAAATTAACCCTCACTAAAGGG

For T7: ATCGATAATACGACTCACTATAGGG

b. Incubate for 2 hours at 37 deg C.

c. Add 2 µl DNase I and incubate 15 minutes at 37 deg C.

d. Add 2 µl 0.2 M EDTA to stop reaction

e. Purify on G-50

End-labeling Ladder

1. On ice mix:

32 µl sample (10 µg 1kb ladder (BRL) H₂O

5 µl 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl₂, 100 mM DTT)

1 µl dig-UTP (alkali-stable ; B-Mann cat. #1093088 or 1558706)

2 µl T4 DNA Polymerase (1u/µl)

2. Incubate 5' at 37 deg C.

3. On ice add:

5 µl 1 mM dATP,dGTP

5 µl 1 mM dCTP

4. Incubate 15' at 30 deg C.

5. Add 6 µl stop solution (2% Sarkosyl 0.4 M EDTA pH 8.0).

6. Purify on G-50 spin column.