Isolation of Retroelement from Plant Genomic DNA，PCR法从植物寻找逆转录元件[Univ

The above protocol is designed to be very reliable. For larger scale and greater specificity, reduce volume to 25 ul or 15 ul, use 0.1 U Taq polymerase per tube and 25% of above primer concentrations. A 'no DNA' control is essential; at different times, we have had major problems with false positive amplifications, so now buy water from Sigma (or other molecular biology supply companies) for use in PCR, DNA dilution, cloning experiments and other critical applications using at most 100s of microlitres. Single-primer controls are also useful to run as some species have nested retroelements in inverted orientations. It is instructive to make 'dirty' controls - with tiny amounts of dust from the lab, your pockets, your hair, powder from gloves etc. (use a tiny amount: the same 'dirt' will inhibit the real reactions, and this inhibition can also be tested in with DNA controls). In a recent course, about 30% of the 'dirty' controls gave amplification products, compared to 5% of clean controls.

Cycling conditions:

Pat
94 °C, 3 mins
[39 °C / 50 secs,
72 °C / 40 secs,
94 °C / 1 min] X 30 cycles
72 °C / 5 mins
4 °C hold

Because the products are short, we usually analyse the products on 2% agarose gels, although note these are expensive and may make subsequent cloning more difficult. However, PCR product cloning kits such as the Invitrogen Topo AT cloning kit or Promega P-Gem T have overcome the difficulties of a few years ago.

Andy Flavell uses the following PCR temperatures (Techne Genius or ancient Hybaid) 95o 1 min [45oC / 1min, 72oC/ 1min, 94oC / 1 min] X 30 cycles 72oC / 7 mins

Alan Schulman

Specific LTR Primers for SSAP, REMAP and IRAP BARE-1 5' CTAGGGCATAATTCCAACAA. This corresponds to the first 19 bases of the BARE-1 LTR, facing outwards from the 5' LTR, plus one selective A base to inhibit internal priming within the BARE-1 element from the 3' LTR (see Waugh, Flavell et al 1997 for reference).

Thv19 5' GCCCAACCGACCAGGTTGTTACAG, corresponding to bases 48-

Some of this work was carried out under EU Framework IV projects TEBIODIV (coordinated by Dr Andy Flavell, University of Dundee) and a Gymnosperm retroelement EU grant (David Marshall, SCRI)

Link to full table on another page Nucleotide degeneracies

R = A G; Y = C T; M = A C; S= G C; W = A T; and N = A G C T.