| Thermal Asymmetric Interlaced Tail PCR | 点击： 作者：51protocol收集 来源： 时间： 2007-03-29 本站论坛
|
|  |
General considerations
1. All reagents and reagent stocks are made with sterile HPLC quality water and are only used for PCR.2. Plan your experiments to fit the format of your plates or tubes (eg 96-well plates) and to maximize the use of multi-channel pipettors. This minimizes the amount of time reagents are in the wells before PCR cycling begins, thus minimizing mis-primed products.3. Use reagent boats or strip tubes for holding reagents while reactions are set up. This will allow you to use a multi-channel pipettor for most additions, thus speeding up the process. You can use pipette tip box lids to cover the reservoirs to prevent passive contamination.4. Taq DNA Polymerase (we use Invitrogen Life Technologies #18038) should be protected from temperature fluctuations by storing and transporting in -20°C cooler boxes.5. We use Invitrogen's pre-mixed 10 mM dNTPs (#18427-013) as a 50x stock in the TAIL reactions. If you are not doing 96-well format reactions, sub-aliquot the solution so that the nucleotides do not go through more than one freeze/thaw cycle.6. The primers are sensitive to freeze-thaw cycles and temperature fluctuations. Sub-aliquot to single-plate amounts and store in boxes that insulate them from freezer temperature fluctuations. Include ~15% excess volume. They are stable on ice for the day, so aliquots thawed for TAIL1 may be used again for TAIL2. Primer preparation: make 10pmol/ml TIR and Arbitrary (AP) primer stocks in TE8 Use freshly unwrapped pipette tips and a carefully stored dedicated TE8 solution for primer stock preparation. Keep everything on ice. Dissolve lyophilized primers in TE8 to a concentration of 100 pmol/ml. Make 1:10 dilutions in TE8, then aliquot in amounts that are typically needed in a day. For primers in regular use, aliquot the entire amount to avoid multiple freeze/thaw cycles. We aliquot our primer sets to PCR strip-tubes for easy pipetting. Store at -20°C. Mu TAIL PCR reaction: TAIL 1
Stock conc. ul for 1X
10X PCR buffer N\A 2
50X dNTP mix 10mM 0.4
25X MgCl2 50mM 0.8
100X TIR6 10pmol/ul 0.2
100X Taq 5 unit/ul 0.2
HPLC H2O N/A 12.4
Total in wells 16
2ul 10X AP
2ul 1:20 template DNA in HPLC water
1. Add 2 ml of the diluted template DNAs to the appropriate wells in a plate kept on ice. Be sure to include a no template sample for each AP. Note that primer GAG3 self-anneals, so you generally will see small bands in this control lane on a gel. All other control lanes should be blank.2. Add 2ml of AP to each well. 3. Turn on the thermal cycler and have it pause at the initial 95°C step to preheat the block and lid. 4. Calculate the number of reactions you have ([#templates x #primers x #replicates] #primers). Add about 15% to get the number of reactions to prepare in your Master Mix (MM). Keep the MM on ice. 5. Put the MM into a reagent boat and add 16ml to each well. Seal plate or tubes, vortex gently. Briefly spin down in a refrigerated tabletop centrifuge. Place in thermal cycler and initiate the TAIL1 program.6. TAIL2 is initiated immediately after TAIL1 is completed. The TAIL1 reactions may be stored for a short period of time at 4°C. At this writing, I do not know how long they can be stored and still generate great TAIL2 products. I have not had good luck doing the TAIL2 reactions the next day. Storing at -20°C degrades the quality of the TAIL1 products for TAIL2.
7. Check 10 ml aliquots of each TAIL1 reaction by gel electrophoresis in a 1% TBE gel. In the gel photo above, our size marker is 1 mg of the Invitrogen 1kb DNA ladder. The TAIL products should range in size from ~200-4000 bp with the bulk of them being in the mid-range. As an example, the photo above shows products from two DNA templates primed with 10 different primers. The blank lanes are no template controls. Primer #8 reactions failed, as did primers #2 and #6 with template A. The faint band at the top of the lane is template DNA. geeky1 reactions usually appear smeared—this is ok. Mu TAIL PCR reaction: TAIL 2
Stock conc. ul for 1X
10X PCR buffer N\A 3
50X dNTP mix 10mM 0.6
25X MgCl2 50mM 1.2
100X TIR8 10pmol/ul 0.3
100X Taq 5 unit/ul 0.3
HPLC H2O N/A 19.6
Total in wells 25
3ul 10X AP
2ul 1:100 TAIL1 reactants in HPLC water
1. Remember to keep all reagents and the TAIL1 products on ice and protected from contamination by using lidded ice boxes. Dilute the TAIL1 products 1:100 in HPLC water (2 ml in 198 ml). Cover the TAIL1 reaction and store it at 4°C. Put 2 ml of the dilution in the corresponding well on the TAIL2 reaction plate. 2. Add 1/10 volume of each AP to the reaction wells (eg 3ml in a 30ml rxn).3. Turn on the thermal cycler and have it pause at the initial 95 degree step to preheat the block and lid.4. Calculate the number of reactions you have ([#templates x #primers x #replicates] #primers). Add about 15% to get the number of reactions to prepare in your Master Mix (MM). Keep the MM on ice.5. Put the MM in a reagent boat and add 25ml to each well. Seal plate or tubes, vortex gently. Briefly spin down in a refrigerated tabletop centrifuge. Place in the thermal cycler and initiate the TAIL2 program.6. Check the TAIL2 reaction by gel electrophoresis and ethidium bromide staining of 7 ml aliquots of each sample. The products will be similar in size but less diverse than the corresponding TAIL1 reaction. As an example, the photo below shows products from two DNA templates primed with 10 different primers. The blank lanes are no template controls. Primers 1,3, and 4 failed with template A.
Thermal cycler programs: The annealing temperatures (67 or 64 degrees) work well in our MWG Biotech Primus96 cyclers. In a Biometra T-Gradient, the temperatures were each 1 degree higher. I think this difference has to do with how temperatures are calculated and attained in each system.
TAIL1 TAIL2
Cycle # Temp (Celsius) Time Cycle # Temp (Celsius) Time
1 95 2 min 1 95 2 min
2 94 30 sec 2 94 10 sec
3 67 1 min 3 64 1 min
4 72 2:30 4 72 2:30
5 Go to 2 4 times 5 94 10 sec
6 94 30 sec 6 64 1 min
7 25 3 min 7 72 2:30
8 25-72 @0.3 degrees/sec 8 94 10 sec
9 72 2:30 9 44 1 min
10 94 10 sec 10 72 2:30
11 67 1 min 11 Go to 2 11 times
12 72 2:30 12 72 5 min
13 94 10 sec 13 4 forever
14 67 1 min
15 72 2:30
16 94 10 sec
17 44 1 min
18 72 2:30
19 Go to 10 14 times
20 72 5 min
21 4 forever
Primer sequences: The 10 pmol/ m l stock is 100x for the TIR primers and 10x for the AP's. TIR6 is used in TAIL1. The four TIR8 primers are mixed together in proportions normalizing their degeneracy (an 11 m l mixture would have 2, 4, 4, 1 m l, respectively of the primers)
Primer Sequence Length #GC %GC Tm Degeneracy
TIR6 AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC 32 17.5 54.7 71.7 4
TIR8.1 CGCCTCCATTTCGTCGAATCCCCTS 25 15 60.0 69.5 2
TIR8.2 CGCCTCCATTTCGTCGAATCCSCTT 25 14 56.0 67.9 4
TIR8.3 SGCCTCCATTTCGTCGAATCCCKT 25 14.5 58.0 68.7 4
TIR8.4 CGCCTCCATTTCGTCGAATCACCTC 25 14 56.0 67.9 1
Tm=81.5 (16.6 x log[Na ]) (41x (#G #C)/ #bases) - 500/#bases
These are the original primers developed by Liu, et al (1995) for Arabidopsis We sometimes use these, but SAD11 and SW41 will cover most of what they would hit :
AD1 XTCGASTWTSGWGTT
AD2 XGTCGASWGAXAWGAA
AD3 WGTGXAGWAXCAXAGA
W4 AGWGXAGWAXCAXAGA
These are the new primers developed by our group that are optimized for maize:
Primer Sequence Length #GC %GC Tm Notes/Degeneracy
cggc1 GVCTYCGWSSGC 12 9.16 76.33 54.5 48
SAD11 NTCAGSTWTSGWGWT 15 6.50 43.33 49.3 AD1 deg 128
SW41 AGWGHAGSAHCADAAS 16 7.00 43.75 51.6 W4 no cp seq/216
上一篇：High-throughput TAIL-PCR as a tool to identify DNA flanking insertions 下一篇：Quick DNA Prep - Used for TAIL PCR 共3页: 上一页 [1] 2 [3] 下一页 | | |
|
|
|
